Please fill out the following fields: job name, email, sequence

One or more parameter you entered is not within range, gRNA length should be between 4 and 50, homology arm length should be between 50 and 500, identity should be between 0 and 1 coverage should be between 0 to 1

PAM length should be between 3 and 10, and containing only letters "A", "T", "C", "G", "N", no space(s).

To search gRNa off-targets in your custom genome, please upload Fasta format genome sequence file, 200MB size limit. Please contact us if you wish to add a frequently used genome to our web-server

please paste your input sequence to search gRNA in. Plain sequence or FASTA format.
plain sequence example:
ATGAGCGTAGCTGTGTGCATGTCAGTCGATGGGCATGCATGCATGCAT
Fasta formate example:
>Tc00.1047053503403.20-trans-sialidase
ATGCTCTCACGTGTTGATGCTGTCAAGGCACCCCGCACACACAACCGTCGCCGCGTGACCGGATCCAGCGGAAGGAGGAGGGAAGGAAGAGAGAGTGAGCCGCAGAGGCCCAACATGTCCCGGCATCACTTCTATTCTGCGGTGCTGCTCCTCCTCGTCGTGATGATGTGCCGCGGCAGTGGAGCTGCGCACGCTTTGGAGAGAAACTCAGGGGATTTGCAAATGCCGCAGGAGATCGCCATGTTTGTGCCGA
Note that sequence name will be truncated at space or special characters: ~!?@#$%^&*(){}[]"'/\,;:

An example consisting of 3 fasta-format sequences have been loaded, please keep T. cruzi genome selected to run the example

A multiple copy gene example has been loaded, this gene has >65 copies in the T. cruzi genome, please keep T. cruzi genome selected to run the example

"load example" will load 3 fasta-format sequences fron the T. cruzi CL strain genome

When determining gRNA on-targets, our program automatically compares the homology of each genomic hit to your gRNA-containing sequence. Sufficient homology would render a genomic hit to be an on-target. The homology arm length determines the length of the regions being compared. For example, homology arm length=50, 50bp upstream of gRNA and 50bp downstream of gRNA, plus gRNA (default 23bp), a total of 123bp will be used to determine homology

When determining gRNA on-targets, our program automatically compares the homology of each genomic hit to your gRNA-containing sequence. Sufficient homology would render a genomic hit to be an on-target. In such process, the identity parameter is the threshold for minimum alignment identity between genomic hits and gRNA-containing sequence.

When determining gRNA on-targets, our program automatically compares the homology of each genomic hit to your gRNA-containing sequence. Sufficient homology would render a genomic hit to be an on-target. In such process, the coverage parameter is the threshold for minimum alignment coverage between genomic hits and gRNA-containing sequence.

You selected a custom genome file to upload, but you didn't select the custom genome option, please select the "upload your custom genome" option under "custom genome" section and click "Get gRNA" again.

You selected the option to upload a custom genome file, but you didn't select anyfile.

For any gene sequences that is less than 100bp, EuPaGDT won't be able to accurately assess gRNA on-targets in the genome .

When determining gRNA off-targets, a genomic sequence will be considered potential off-target if the alignment of it with gRNA has less than n mismatches. "n" is the "maximum number of mismatch" parameter value

RNA-guided nucleases such as Cas9 can cleave targets using alternative PAMs at lower efficiency.

For example SpCas9 can also use PAM "NAG", "NGA"(with lower efficiency compared to "NGG");
gRNA "ATCGATCGATCGATCGATCG|NGG" could have the off-targets:
"ATCGATCGATCGATCGATCG|NAG",
"ATCGATCGATCGATCGATCG|NGA"
in undesired loci.

This is the number of top-ranking gRNAs will be chosen for each of your input sequence.

Please do not include special characters such as !@#$%^&().,; in job names

parameter for "% of length of input sequence" should be between 1 and 100

In some scenarios such as gene knockout experiment, it is preferred to disrupt genes at positions closer to start codon to prevent production of truncated protein that may have partial functionality.

Input parameter error alert:
UTR length is shorter than HDR template homology arm length. HDR template homology arm will not have enough sequence information

The following parameters will be automatically set if respective nuclease is chosen:

SpCas9: gRNA length 20; PAM: NGG; off-target PAM: NAG, NGA

SaCas9: gRNA length 21; PAM: NNGRRT; off-target PAM: NNGRRA,NNGRRG,NNGRRC

Conserved regions are identified by tblastx (translated query vs translated database) input sequence against the following 13 genomes:
Mus Musculus,
S.cerevisiae S288c,
D. melanogaster r6.10,
N. crassa OR74A,
E. histolytica HM1IMSS-B,
C. parvum IowaII,
P. falciparum 3D7,
T. gondii ME49,
T. cruzi CLBrener,
L. donovani BPK282A1,
G. intestinalis AssemblageA,
E. cuniculi GBM1,
T. annulata Ankara.
A region of input sequence is marked as conserved region if tblastx-matches are found for at least 12 out of 13 genomes.

Please use IUPAC code for degenerative base(s) in PAM motif

IUPAC nucleotide code	Base
A	Adenine
C	Cytosine
G	Guanine
T	Thymine
R	A or G
Y	C or T
S	G or C
W	A or T
K	G or T
M	A or C
B	C or G or T
D	A or G or T
H	A or C or T
V	A or C or G
N	any base

Reference: IUPAC-IUB SYMBOLS FOR NUCLEOTIDE NOMENCLATURE: Cornish-Bowden (1985) Nucl. Acids Res. 13: 3021-3030.

Please specify HDR insertion sequence in the "HDR oligo template parameters" section.

Eukaryotic Pathogen CRISPR guide RNA/DNA Design Tool

with (1) custom genome upload, (2) off-target analysis, (3) on-targets searching (for targeting gene families), (4) efficiency/activity prediction, (5) assisted oligo repair template design , (6) gRNA transcription problem identification, (7) flanking microhomology searching (for predicting deletions)

Gene Tagging Batch Mode

Predict gRNA and HDR template to insert tags

after start codons and before stop codons

upload and process multiple sequences in one run

if you are processing one gene, please use this link

Please flank your ORF with UTR sequence, and specify length of UTRs

Job Name:

RNA/DNA guided nuclease selection:(?)

choose one to automatically configure gRNA/gDNA and PAM settings for each nuclease

Additional option settings: (click to expand a category)

Batch process parameters (please click to review!)

Only 2 gRNAs will be picked for each input sequence.
One for 5' tagging, the other for 3' tagging
The successful gRNAs should pass the below filter for quality:

minimum gRNA efficay score:

minimum gRNA GC%:

maximum gRNA GC%:

Each sequence can be in the format of 5'UTR-ORF-3'UTR,
Please specify UTR length in your sequence

5' UTR length: (50-90bp recommended)

3' UTR length: (50-90bp recommended)

HDR oligo template parameters (for tagging)

For each gRNA, a HDR oligo repair template will be provided,
for the insertion of a custom sequence (tag) into your gene.
The insertion sequence would be arranged in an in-frame fashion
(assuming 1st reading frame in your input sequence,
e.g. first 3 nt is a codon and so on so forth)

homology arm length:(?)

insertion:(?)

gRNA search parameters

gRNA length:

PAM motif(s):
(use comma to separate multiple PAM motifs
use IUPAC code for degenerate base)

on-target search parameters

(Default settings
recommended for most users)

homology arm length:(?)
identity:(?)
coverage:(?)

off-target search parameters

(Default settings
recommended for most users)

maximum number
of mismatches:(?)

off-target PAM motif(s)(?):
(comma separated if more than one,
use IUPAC code for degenerate base)

Genome (expand a category and choose one):

genome naming paradigm:
specie strain database-version

Sequence:(?)

or upload your fasta file here:

(?)	(?)

(please use Chrome browser or enable Javascript in your browser for optimal results)

EuPaGDT